Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1628693
End position: 1628719
Length: 27

DNA sequence
>NC_014814, from 1628693 to 1628719 (27 bp); Mycobacterium sp. Spyr1 CCGCCGGCGCCGCCGGTGCCGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1628246-1629619	Sequence	Mspyr1_16100 - hypothetical protein (Protein is coded in complementary strand; from 1629619 to 1628246)