Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1487421
End position: 1487444
Length: 24

DNA sequence
>NC_014814, from 1487421 to 1487444 (24 bp); Mycobacterium sp. Spyr1 CGAGCCGACGCGCCGACGGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1486961-1487923	Sequence	Mspyr1_14650 - lysophospholipase L1-like esterase (Protein is coded in complementary strand; from 1487923 to 1486961)