Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1397560
End position: 1397583
Length: 24

DNA sequence
>NC_014814, from 1397560 to 1397583 (24 bp); Mycobacterium sp. Spyr1 GTCGGCGTCGGTATCGGCTTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1397429-1397608	Sequence	Mspyr1_13720 - hypothetical protein (Protein is coded in complementary strand; from 1397608 to 1397429)