Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1247264
End position: 1247290
Length: 27

DNA sequence
>NC_014814, from 1247264 to 1247290 (27 bp); Mycobacterium sp. Spyr1 GAGTCGTCGGAGTCGTCGGAGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1247141-1248127	Sequence	Mspyr1_12260 - DNA end-binding protein Ku (Protein is coded in complementary strand; from 1248127 to 1247141)