Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1133343
End position: 1133378
Length: 36

DNA sequence
>NC_014814, from 1133343 to 1133378 (36 bp); Mycobacterium sp. Spyr1 CGCGGACACCGACGCAGACCCCGACGCAGACCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1132922-1135555	Sequence	Mspyr1_11080 - beta-glucosidase/6-phospho-beta-glucosidase/beta-galactosidase