Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1066038
End position: 1066061
Length: 24

DNA sequence
>NC_014814, from 1066038 to 1066061 (24 bp); Mycobacterium sp. Spyr1 CCGCCACCGCGAGCGCCACCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1065809-1066165	Sequence	Mspyr1_10480 - hypothetical protein (Protein is coded in complementary strand; from 1066165 to 1065809)