Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1061335
End position: 1061358
Length: 24

DNA sequence
>NC_014814, from 1061335 to 1061358 (24 bp); Mycobacterium sp. Spyr1 GGGCTCGGGTTCGGGTTCGGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1059653-1061602	Sequence	Mspyr1_10430 - cell envelope-related transcriptional attenuator (Protein is coded in complementary strand; from 1061602 to 1059653)