Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1032219
End position: 1032245
Length: 27

DNA sequence
>NC_014814, from 1032219 to 1032245 (27 bp); Mycobacterium sp. Spyr1 CGTCGGGGTCGTCGGTGTCGTCGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1032155-1033189	Sequence	Mspyr1_10130 - dyp-type peroxidase family protein (Protein is coded in complementary strand; from 1033189 to 1032155)