Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 769962
End position: 770009
Length: 48

DNA sequence
>NC_014759, from 769962 to 770009 (48 bp); Marivirga tractuosa DSM 4126 TAGCCATAGCCGTAACCATAGCCGTAGCCGTAGCCGTAGCCATAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 769920-772343	Sequence	Ftrac_0603 - capsular exopolysaccharide family protein (Protein is coded in complementary strand; from 772343 to 769920)