Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 4483232
End position: 4483255
Length: 24

DNA sequence
>NC_014759, from 4483232 to 4483255 (24 bp); Marivirga tractuosa DSM 4126 TTTTTCTTTTTCTTCTTCTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4483199-4484350	Sequence	Ftrac_3783 - iron-regulated transmembrane protein (Protein is coded in complementary strand; from 4484350 to 4483199)