Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 4240933
End position: 4240956
Length: 24

DNA sequence
>NC_014759, from 4240933 to 4240956 (24 bp); Marivirga tractuosa DSM 4126 GATATTGATTTTGTTATTGATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4240820-4241122	Sequence	Ftrac_3585 - DNA polymerase beta domain-containing protein region