Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 3267414
End position: 3267443
Length: 30

DNA sequence
>NC_014759, from 3267414 to 3267443 (30 bp); Marivirga tractuosa DSM 4126 GAATACAAATAAATACTAATGACTACAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3265929-3267476	Sequence	Ftrac_2777 - hypothetical protein (Protein is coded in complementary strand; from 3267476 to 3265929)