Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 303851
End position: 303886
Length: 36

DNA sequence
>NC_014759, from 303851 to 303886 (36 bp); Marivirga tractuosa DSM 4126 TAGCTCCGTCAATAGCTCCGTCAATAGCTCCGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 303628-305109	Sequence	Ftrac_0231 - transcriptional regulator (Protein is coded in complementary strand; from 305109 to 303628)