Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 2814648
End position: 2814671
Length: 24

DNA sequence
>NC_014759, from 2814648 to 2814671 (24 bp); Marivirga tractuosa DSM 4126 TCCATTTCCATGCCCATTTGCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2813673-2817074	Sequence	Ftrac_2381 - hypothetical protein (Protein is coded in complementary strand; from 2817074 to 2813673)