Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 214215
End position: 214256
Length: 42

DNA sequence
>NC_014759, from 214215 to 214256 (42 bp); Marivirga tractuosa DSM 4126 CTACTCAGTACCCACTACCCATTACCCACTACTCATTACTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 214251-215363	Sequence	Ftrac_0170 - zn-dependent hydrolase of the beta-lactamase fold family (Protein is coded in complementary strand; from 215363 to 214251)