Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 1506476
End position: 1506505
Length: 30

DNA sequence
>NC_014759, from 1506476 to 1506505 (30 bp); Marivirga tractuosa DSM 4126 TTTTTTTTGTTTTTTTTTCTTTTCTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1506421-1506555	Sequence	Ftrac_1228 - hypothetical protein (Protein is coded in complementary strand; from 1506555 to 1506421)