Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 1190490
End position: 1190513
Length: 24

DNA sequence
>NC_014759, from 1190490 to 1190513 (24 bp); Marivirga tractuosa DSM 4126 ATCATCATCGTCATCATTATCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1190116-1190634	Sequence	Ftrac_0957 - hypothetical protein (Protein is coded in complementary strand; from 1190634 to 1190116)