Sequence retrieval

Genome: Marivirga tractuosa DSM 4126
Start position: 1043681
End position: 1043710
Length: 30

DNA sequence
>NC_014759, from 1043681 to 1043710 (30 bp); Marivirga tractuosa DSM 4126 AATTTTTCAACCTTTTTCAAAAGTTTTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1043528-1043767	Sequence	Ftrac_0841 - hypothetical protein (Protein is coded in complementary strand; from 1043767 to 1043528)