Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 91547
End position: 91573
Length: 27

DNA sequence
>NC_014729, from 91547 to 91573 (27 bp); Halogeometricum borinquense DSM 11551 CTGCATCTGCTGCATCTGCTGCATCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 91530-91991	Sequence	Hbor_01040 - prefoldin alpha subunit/subunit 5 (Protein is coded in complementary strand; from 91991 to 91530)