Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 882421
End position: 882444
Length: 24

DNA sequence
>NC_014729, from 882421 to 882444 (24 bp); Halogeometricum borinquense DSM 11551 TCGGATTCGGCTTCGGATTCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 882307-883152	Sequence	Hbor_09390 - phage shock protein a (im30), suppresses sigma54-dependent transcription (Protein is coded in complementary strand; from 883152 to 882307)