Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 771052
End position: 771087
Length: 36

DNA sequence
>NC_014729, from 771052 to 771087 (36 bp); Halogeometricum borinquense DSM 11551 CGGTCGGTGTCGCGGTTGGCGTCGCGGTCGGTGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 770964-775742	Sequence	Hbor_08300 - hypothetical protein (Protein is coded in complementary strand; from 775742 to 770964)