Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 693373
End position: 693402
Length: 30

DNA sequence
>NC_014729, from 693373 to 693402 (30 bp); Halogeometricum borinquense DSM 11551 GTCGGCACGCGTCGGGACGACTCGGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 693038-693913	Sequence	Hbor_07480 - homoserine kinase (Protein is coded in complementary strand; from 693913 to 693038)