Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 57425
End position: 57451
Length: 27

DNA sequence
>NC_014729, from 57425 to 57451 (27 bp); Halogeometricum borinquense DSM 11551 CCATACAGGCCATACAGGCCATACAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 56419-58536	Sequence	Hbor_00670 - Fe-S oxidoreductase (Protein is coded in complementary strand; from 58536 to 56419)