Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 291605
End position: 291628
Length: 24

DNA sequence
>NC_014729, from 291605 to 291628 (24 bp); Halogeometricum borinquense DSM 11551 CGCCGACGCGGACGCCGATGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 291220-292731	Sequence	Hbor_03090 - phenylalanyl-tRNA synthetase subunit alpha