Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 253513
End position: 253545
Length: 33

DNA sequence
>NC_014729, from 253513 to 253545 (33 bp); Halogeometricum borinquense DSM 11551 CGTTATCGCGTCGTTACCGCGTCGTCATCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 253538-253726	Sequence	Hbor_02720 - hypothetical protein (Protein is coded in complementary strand; from 253726 to 253538)