Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 2465482
End position: 2465553
Length: 72

DNA sequence
>NC_014729, from 2465482 to 2465553 (72 bp); Halogeometricum borinquense DSM 11551 CCGACTGACGAAGTGACCGACACGCCGACTGACGAAGTGACCGACACGCCGACCGATGAAGTGACCGACA CG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2463727-2465490	Sequence	Hbor_25780 - na+ antiporter
ORF. 2465474-2465569	Sequence	Hbor_25790 - hypothetical protein