Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 2462349
End position: 2462375
Length: 27

DNA sequence
>NC_014729, from 2462349 to 2462375 (27 bp); Halogeometricum borinquense DSM 11551 GAGGGCGAGGACGGCGAGGACGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2461474-2462406	Sequence	Hbor_25760 - hypothetical protein (Protein is coded in complementary strand; from 2462406 to 2461474)