Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 2204203
End position: 2204226
Length: 24

DNA sequence
>NC_014729, from 2204203 to 2204226 (24 bp); Halogeometricum borinquense DSM 11551 CCGTCGCCGTGGCCGTCTCAGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2204091-2206772	Sequence	Hbor_23100 - hypothetical protein (Protein is coded in complementary strand; from 2206772 to 2204091)