Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 2037123
End position: 2037146
Length: 24

DNA sequence
>NC_014729, from 2037123 to 2037146 (24 bp); Halogeometricum borinquense DSM 11551 ACGAAAACGATAACGAAGACGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2035845-2037179	Sequence	Hbor_21310 - arabinose efflux permease (Protein is coded in complementary strand; from 2037179 to 2035845)