Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1983404
End position: 1983471
Length: 68

DNA sequence
>NC_014729, from 1983404 to 1983471 (68 bp); Halogeometricum borinquense DSM 11551 GAGCGCGTCATCCGTTCGAGCGCATCATCCGTTCGAGCGCATCATCCGTTCGAGCGCATCATCCGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1983128-1983406	Sequence	Hbor_20730 - ribonuclease p protein subunit rpp21