Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1941454
End position: 1941477
Length: 24

DNA sequence
>NC_014729, from 1941454 to 1941477 (24 bp); Halogeometricum borinquense DSM 11551 CCTCTTCGTCTTCTTCTTCGTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1940838-1942208	Sequence	Hbor_20270 - flagella protein/flagella accessory protein c (flac) (Protein is coded in complementary strand; from 1942208 to 1940838)