Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1703774
End position: 1703797
Length: 24

DNA sequence
>NC_014729, from 1703774 to 1703797 (24 bp); Halogeometricum borinquense DSM 11551 AGGCGACGGCGAAGGCGTAGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1703134-1704207	Sequence	Hbor_17720 - NADH dehydrogenase subunit h (Protein is coded in complementary strand; from 1704207 to 1703134)