Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1602801
End position: 1602836
Length: 36

DNA sequence
>NC_014729, from 1602801 to 1602836 (36 bp); Halogeometricum borinquense DSM 11551 CGAACAGACCGACGAGCGGACCGACCAACAGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1601648-1603315	Sequence	Hbor_16750 - hypothetical protein (Protein is coded in complementary strand; from 1603315 to 1601648)