Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1575000
End position: 1575044
Length: 45

DNA sequence
>NC_014729, from 1575000 to 1575044 (45 bp); Halogeometricum borinquense DSM 11551 TCTGACGTTTCGTCGTCTGGCGCTTCTTCGTCCGACGCTTCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1574964-1577549	Sequence	Hbor_16520 - DNA gyrase subunit a (Protein is coded in complementary strand; from 1577549 to 1574964)