Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1547672
End position: 1547716
Length: 45

DNA sequence
>NC_014729, from 1547672 to 1547716 (45 bp); Halogeometricum borinquense DSM 11551 GCCGAAGCGGAGACTGCTGAAACCGAGACTGCTGAAGCGGAGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1547508-1548278	Sequence	Hbor_16230 - molecular chaperone grpe (heat shock protein)