Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1373008
End position: 1373031
Length: 24

DNA sequence
>NC_014729, from 1373008 to 1373031 (24 bp); Halogeometricum borinquense DSM 11551 GCGTTGGCGTTCCCGTTGGCGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1372951-1374279	Sequence	Hbor_14630 - hypothetical protein (Protein is coded in complementary strand; from 1374279 to 1372951)