Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1344866
End position: 1344889
Length: 24

DNA sequence
>NC_014729, from 1344866 to 1344889 (24 bp); Halogeometricum borinquense DSM 11551 CGAGTGCGCGTGCGAGGGCGAGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1344685-1345650	Sequence	Hbor_14300 - zn-dependent protease with chaperone function (Protein is coded in complementary strand; from 1345650 to 1344685)