Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1321613
End position: 1321636
Length: 24

DNA sequence
>NC_014729, from 1321613 to 1321636 (24 bp); Halogeometricum borinquense DSM 11551 GCGACGGCGACGACGACGGCGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1321175-1321780	Sequence	Hbor_14040 - hypothetical protein (Protein is coded in complementary strand; from 1321780 to 1321175)