Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1320466
End position: 1320510
Length: 45

DNA sequence
>NC_014729, from 1320466 to 1320510 (45 bp); Halogeometricum borinquense DSM 11551 TTTCGGCTTCTGCGGTTTCGGCTTCTGCGCTTTCAGTTTCTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1318890-1321004	Sequence	Hbor_14030 - recj-like exonuclease with dnaj-type zn-finger domain (Protein is coded in complementary strand; from 1321004 to 1318890)