Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1301279
End position: 1301314
Length: 36

DNA sequence
>NC_014729, from 1301279 to 1301314 (36 bp); Halogeometricum borinquense DSM 11551 CAGAACCAGAACCAGAACCAGAACCAGAACCAGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1301227-1301880	Sequence	Hbor_13860 - hypothetical protein (Protein is coded in complementary strand; from 1301880 to 1301227)