Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1132991
End position: 1133014
Length: 24

DNA sequence
>NC_014729, from 1132991 to 1133014 (24 bp); Halogeometricum borinquense DSM 11551 CCTCTTCGTCTTCCTCTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1132957-1133289	Sequence	Hbor_12230 - 50S ribosomal protein L12ae (Protein is coded in complementary strand; from 1133289 to 1132957)