Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1102317
End position: 1102340
Length: 24

DNA sequence
>NC_014729, from 1102317 to 1102340 (24 bp); Halogeometricum borinquense DSM 11551 CCGCCACTGCCACCGGCACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1102146-1103207	Sequence	Hbor_11870 - halocyanin domain-containing protein (Protein is coded in complementary strand; from 1103207 to 1102146)