Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1088670
End position: 1088693
Length: 24

DNA sequence
>NC_014729, from 1088670 to 1088693 (24 bp); Halogeometricum borinquense DSM 11551 GGCGTCGGAGTCGGCGGCGGCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1087924-1089033	Sequence	Hbor_11690 - dehydrogenase (Protein is coded in complementary strand; from 1089033 to 1087924)