Sequence retrieval

Genome: Halogeometricum borinquense DSM 11551
Start position: 1060052
End position: 1060102
Length: 51

DNA sequence
>NC_014729, from 1060052 to 1060102 (51 bp); Halogeometricum borinquense DSM 11551 CTGAATCCAAGTCGAGGCTGAATCCAAGTCGAGGCTGAATCCAAGTCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1059631-1060056	Sequence	Hbor_11410 - universal stress family protein