Sequence retrieval

Genome: Lactobacillus delbrueckii subsp. bulgaricus ND02
Start position: 494231
End position: 494284
Length: 54

DNA sequence
>NC_014727, from 494231 to 494284 (54 bp); Lactobacillus delbrueckii subsp. bulgaricus ND02 AAGAAGAAAAAGAAGTCCAAGAAGAAAAAGAAGTCCAAGAAGAAAAACAAGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 493071-494333	Sequence	LDBND_0483 - ATP-dependent RNA helicase, dead-deah box