Sequence retrieval

Genome: Lactobacillus delbrueckii subsp. bulgaricus ND02
Start position: 1733783
End position: 1733806
Length: 24

DNA sequence
>NC_014727, from 1733783 to 1733806 (24 bp); Lactobacillus delbrueckii subsp. bulgaricus ND02 CAGCTGCGGCTGCAGGTGCAGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1733194-1734228	Sequence	LDBND_1687 - phosphotransferase system, mannose/fructose-specific component iia (Protein is coded in complementary strand; from 1734228 to 1733194)