Sequence retrieval

Genome: Lactobacillus delbrueckii subsp. bulgaricus ND02
Start position: 1533707
End position: 1533730
Length: 24

DNA sequence
>NC_014727, from 1533707 to 1533730 (24 bp); Lactobacillus delbrueckii subsp. bulgaricus ND02 TTCTTCTTCTACTACTTCTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1533126-1534295	Sequence	LDBND_1488 - hypothetical protein (Protein is coded in complementary strand; from 1534295 to 1533126)