Sequence retrieval

Genome: Lactobacillus delbrueckii subsp. bulgaricus ND02
Start position: 152841
End position: 152888
Length: 48

DNA sequence
>NC_014727, from 152841 to 152888 (48 bp); Lactobacillus delbrueckii subsp. bulgaricus ND02 TTTCTTACTAGATTTTTTTCTAGACTTCTTGCTAGATTTCTTACTAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 152767-154074	Sequence	LDBND_0156 - hypothetical protein (Protein is coded in complementary strand; from 154074 to 152767)