Sequence retrieval

Genome: Burkholderia rhizoxinica HKI 454
Start position: 824675
End position: 824728
Length: 54

DNA sequence
>NC_014722, from 824675 to 824728 (54 bp); Burkholderia rhizoxinica HKI 454 TGCTCGTGCTCGTGCTCGTGCTCGTGCTCGTGCTCGTGCTCGTGCTCGTGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 824390-824779	Sequence	RBRH_01076 - Pirin (Protein is coded in complementary strand; from 824779 to 824390)
ORF... 824687-824815	Sequence	RBRH_01075 - hypothetical protein