Sequence retrieval

Genome: Burkholderia rhizoxinica HKI 454
Start position: 2202127
End position: 2202189
Length: 63

DNA sequence
>NC_014722, from 2202127 to 2202189 (63 bp); Burkholderia rhizoxinica HKI 454 GCACTAGTAGCACTAGTAGCACTAGTAGCACTAGTAGCACTAGTAGCACTAGTAGCACTAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2201275-2203287	Sequence	RBRH_01377 - alpha-L-glycero-D-manno-heptose beta-1,4-glucosyltransferase